klebsiella en agar emb

bacteria thas is Escherichia coli, Klebsiella pneumoniae, Proteus vulgaris, EMB-Agar medium and incubated for 24 hours at 350C. Three different strains of Klebsiella pneumoniae on Endo agar with biochemical Petri dish klebsiella pneumoniae colonies in detail on MacConkey agar. ⇒ The Eosin Methylene Blue Agar (EMB Agar) medium which is the Selective medium for Klebsiella pneumoniae contains Eosin dye and Methylene Blue. klebsiella en agar emb

Klebsiella en agar emb -

Klebsiella pneumoniae

microscope picturegram-negative rods

Mucous, lactose positive colonies of Klebsiella pneumoniae on MacConkey agar. Cultivation 37°C, 24 hours.

As a general rule, Klebsiella infections tend to occur in people with a weakened immune system. Many of these infections are obtained when a person is in the hospital for some other reason (a nosocomial infection). The most common infection caused by Klebsiella bacteria outside the hospital is pneumonia. Klebsiella ranks second to E. coli for urinary tract infections in older persons. It is also an opportunistic pathogen for patients with chronic pulmonary disease, enteric pathogenicity, nasal mucosa atrophy, and rhinoscleroma. Feces are the most significant source of patient infection, followed by contact with contaminated instruments.
Microscopy:
Gram-negative, non-motile, encapsulated, rod shaped bacterium.
Источник: http://www.bacteriainphotos.com/Klebsiella%20pneumoniae%20on%20MacConkey.html

Microbiology & parasitology

Essential features

  • Gram negative, rod shaped, facultatively anaerobic
  • Lactose fermenting, indole positive
  • Many anatomic and environmental sources
  • Opportunistic pathogenic, multiple sites
    • Antibiotic associated hemorrhagic diarrhea
    • Cytotoxin
  • Frequently antibiotic resistant, including extended spectrum beta lactamases (ESBLs)

Pathophysiology

  • Presence of heat labile cytotoxin important virulence factor for hemorrhagic colitis (J Clin Microbiol 2010;48:817, J Biol Chem 2017;292:19503)
  • Gram negative organism, contains immunogenic lipopolysaccharide (LPS) anchored in outer membrane
  • Multiple antibiotic resistance mechanisms, of note:
    • K. oxytoca specific beta lactamase, blaOXY (J Antimicrob Chemother 2015;70:3230)
    • Klebsiella spp. are ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter) which often are multidrug resistant (Clin Infect Dis 2009;48:1)

Clinical features

  • Hospital acquired infections are similar to other nosocomial bacterial infections (with gram negative organisms)

Laboratory

  • Aerobic growth in routine culture conditions, 37°C
  • Growth at 44°C
  • Growth on blood agar (nonhemolytic)
  • Ferments lactose (pink colonies) on MacConkey agar
  • Medium sized, slightly mucoid, yellow to cream colored colonies
  • Indole positive, differentiates from other Klebsiella spp.
  • MALDI-TOF mass spectrometry

Treatment

  • Likely to harbor multidrug resistance mechanisms (example: extended spectrum beta lactamase [ESBL])
  • Carbapenems are typically treatment of choice when ESBL suspected in significantly ill patients
  • Empiric treatment guided by local resistance
  • Definitive treatment depends on phenotypic antibiotic susceptibility testing
  • Pharmacy consultation may be useful, as some drugs (cephalosporins) may be sensitive in vitro but are unlikely useful for clinical treatment in the case of various ESBL carrying organisms, including Klebsiellae (J Clin Microbiol 2001;39:2206)

Clinical images


Contributed by Joshua A. Lieberman, M.D, Ph.D.

K. pneumoniae,
K. oxytoca and
β hemolytic Streptococcus

K. oxytoca on a blood agar plate

Microscopic (histologic) description

  • 2 x 5 micron rod shaped, gram negative bacteria

Microscopic (histologic) images


Contributed by Joshua A. Lieberman, M.D, Ph.D.

Gram stain of
K. oxytoca

Molecular / cytogenetics description

  • 16S rDNA sequencing does not differentiate from closely related Raoultella spp.

Differential diagnosis

  • Klebsiella pneumoniae
    • Also gram negative, lactose fermenting organism and member of the same genus
    • Indole negative
    • Robust polysaccharide capsule
  • Raoultella spp.
    • Closely related Enterobacteriales member
    • Not readily distinguished, even with 16S rDNA amplicon based sequencing
  • Other Enterobacteriales
    • Includes Citrobacter freundii, Escherichia coli, Shigella spp., Enterobacter spp. and others
    • Most commonly MALDI-TOF mass spectrometry or sequence based identification
    • Can distinguish with fermentation / metabolic test strips but use of these is rapidly vanishing
  • Non-Enterobacteriales nosocomial infections
    • Example: Pseudomonas aeruginosa
      • Longer and thinner morphology
      • Nonlactose fermenting
      • Also have mucoid colony appearance

Board review style question #1

The clinical microbiology laboratory has isolated a gram negative rod from the sputum of a homeless, alcoholic patient with a chronic cough. The isolate forms a mucoid colony that turns pink on MacConkey agar and produces a blue spot when placed on filter paper and treated with indole. What is the most likely organism?

  1. Chlamydia pneumoniae
  2. Klebsiella oxytoca
  3. Klebsiella pneumoniae
  4. Pseudomonas aeruginosa

Board review style answer #1

B. K. oxytoca. Only K. pneumoniae, K. oxytoca and Pseudomonas aeruginosa are gram negative bacilli. Klebsiella spp. ferment lactose (pink on MacConkey's agar), while P. aeruginosa does not ferment lactose. Between K. pneumoniae and K. oxytoca, only K. oxytoca is indole positive. While Chlamydia pneumoniae is gram negative, it is not a bacillus but exists either as a reticulate body (RB) when replicating within host cells (phagolysosomes) or as an infectious elementary body (EB) when passing between cells. C. pneumoniae, like C. trachomatis is therefore not cultured clinically because it requires growth in a eukaryotic cell.

Comment here

Reference: Klebsiella oxytoca

Board review style question #2

For Klebsiella oxytoca, which of the following mechanisms of antibiotic resistance is most important?

  1. 23S rRNA mutation
  2. Altered cell wall components
  3. Drug hydrolyzing enzyme
  4. Mutation in topoisomerase

Board review style answer #2

C. K. oxytoca carries extended spectrum beta lactamases (ESBLs) which can hydrolyze cephalosporins and other beta lactam antibiotics. Specific resistances vary significantly based on the ESBL identified. In addition, some strains will upregulate drug efflux pumps and ESBL production under antibiotic treatment. Mutation of the 23S rRNA is one mechanism of macrolide resistance. The van operon (especially vanA, vanB) confer vancomycin resistance in Enterococci, as well as Lactobacillus and other anaerobes by changing the peptidoglycan structure to D-Ala-D-Lactate. Fluoroquinolone / quinolone anitbiotics inhibit topoisomerase (DNA gyrase) enzymes and mutations in these genes are an important mechanism of resistance to this class of antibiotics.

Comment here

Reference: Klebsiella oxytoca

Back to topИсточник: https://www.ncbi.nlm.nih.gov/pubmed/" target="_blank
K. pneumoniae  Gram Stain

#K. pneumoniae  growth on MacConkey agar, blood agar, and chocolate agar-

#Staphylococcus aureus , E. coli, and K. penumoniae on growth on various media

Further Readings

  1. Bailey & Scott’s Diagnostic Microbiology. Editors: Bettey A. Forbes, Daniel F. Sahm & Alice S. Weissfeld, 12th ed 2007, Publisher Elsevier.
  2. Clinical Microbiology Procedure Handbook Vol. I & II, Chief in editor H.D. Isenberg, Albert Einstein College of Medicine, New York, Publisher ASM (American Society for Microbiology), Washington DC.
  3. Colour Atlas and Textbook of Diagnostic Microbiology. Editors: Koneman E.W., Allen D.D., Dowell V.R. Jr, and Sommers H.M.
  4. Cowan & Steel’s Manual for identification of Medical Bacteria. Editors: G.I. Barron & R.K. Felthani, 3rd ed 1993, Publisher Cambridge University Press.
  5. Jawetz, Melnick and Adelberg’s Medical Microbiology. Editors: Geo. F. Brook, Janet S. Butel & Stephen A. Morse, 21st ed 1998, Publisher Appleton & Lance, Co Stamford Connecticut.
  6. Mackie and Mc Cartney Practical Medical Microbiology. Editors: J.G. Colle, A.G. Fraser, B.P. Marmion, A. Simmous, 4th ed, Publisher Churchill Living Stone, New York, Melborne, Sans Franscisco 1996.
  7.  Manual of Clinical Microbiology. Editors: P.R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover and R. H. Yolken, 7th ed 2005, Publisher ASM, USA
  8.  Textbook of Diagnostic Microbiology. Editors: Connie R. Mahon, Donald G. Lehman & George Manuselis, 3rd edition2007, Publisher Elsevier.
  9. Topley & Wilsons Principle of Bacteriology Vol I, Editors: M.T. Parker & L.H. Collier, 8th ed 1990, Publisher Edward Arnold publication, London.
  10. District Laboratory Practice in  Tropical Countries  –  Part-2-   Monica Cheesebrough-   2nd Edn Update
Источник: http://universe84a.com/collection/klebsiella-pneumoniae-macconkey-agar/
2009, Cilt 39, Sayı 1-2, Sayfa(lar) 016-021 [ Türkçe Özet ] [ PDF ] [ Benzer Makaleler ] EXTENDED SPECTRUM BETA LACTAMASES PRODUCTION AND ANTIMICROBIAL RESISTANCE RATIO OF THE ESCHERICHIA COLI AND KLEBSIELLA PNEUMONIAE STRAINS ISOLATED FROM VARIOUS CLINICAL SPECIMENSNurhan ALBAYRAK1, Şafak KAYA21Çankırı Devlet Hastanesi, Mikrobiyoloji ve Klinik Mikrobiyoloji, Çankırı
2Çankırı Devlet Hastanesi, İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji, ÇankırıKeywords: Escherichia coli, Klebsiella pneumoniae, extended spectrum beta lactamases

Th e aim of this study was to determine the antibiotic sensitivity to Escherichia coli and Klebsiella pneumoniae strains isolated in Microbiology Laboratory of Çankırı State Hospital between January 2007 - March 2008. Urine, sputum and wound samples which send from various clinics were inoculated both sheep blood agar and EMB agar; and blood samples added to biphasic blood culture medium (Biomeriux) in accordance with routine procedures. Sputum and wound samples were analysed for the presence or absence of leukocytes with gram staining. Microorganisms identification have been realized according to the biochemical properties. Micoorganisms can not be identified with convational methods were determined with semi automized systems (Biomeriux; Api 20E). To some antimicrobial agents, antimicrobial susceptility was been made by Keurby Bauer disk diff usion testing according to the recommendations of Clinical Laboratory Standards Institute (CLSI). Extended spectrum beta-lactamase production of Escherichia coli and Klebsiella pneumoniae strains were evaluated by double disk synergy method. In this time period 3156 urine, 703 sputum, 255 wound and 246 blood culture samples were sent to our laboratory. In 876 sample (20.9%) at least one bacteria was been isolated of total of the 4360 samples. Escherichia coli isolated from 347 sample and Klebsiella pneumoniae isolated from 91 sample. Th e extended spectrum beta-lactamase production rate was 18.8 % (n=73) in Escherichia coli, and 21.9% (n=20) in Klebsiella pneumoniae. Lower susceptibilty rates were determined among Escherichia coli and Klebsiella pneumoniae strains especially against amoxicillin/clavulonic acid and cefalosporins which are oft en used as empirical antimicrobials in various infections. Karbapenem resistance was shown only in a one Escherichia coli strain; karbapenem's still appear to be the most eff ective antibiotic against all tested bacteria.


[ Türkçe Özet ] [ PDF ] [ Benzer Makaleler ]
Источник: http://tmc.dergisi.org/summary_en.php3?id=338

Klebsiella pneumoniae on MacConkey Agar

Klebsiella pneumoniae on MacConkey agar is a mucoid and lactose fermenter isolated from urine as shown above picture.

K. pneumoniae scientific classification is as follows-

  • Domain: Bacteria
  • Phylum: Proteobacteria
  • Class: Gammaproteobacteria
  • Order: Enterobacterales
  • Family: Enterobacteriaceae
  • Genus: Klebsiella
  • Species:  pneumoniae
  • Subspcecies of Klebsiella pneumoniae are-
  • Klebsiella pneumoniae subspecies ozaenae
  • Klebsiella pneumoniae subspecies  pneumoniae
  • Klebsiella pneumoniae subspecies rhinoscleromatis

Klebsiella is from the surname of  German-Swiss microbiologist Edwin Klebs (1834–1913). Klebsiella is a genus of Gram-negative, oxidase-negative, fimbriated, non -motile, non-sporing rod-shaped bacteria with a prominent polysaccharide-based capsule and having size o,f   0.5 -0.8 µm wide to 1 -2  µm. They are found everywhere in nature and also in bacterial flora in our intestines.

Pathogenicity of Klebsiella pneumoniae

It may cause severe bronchopneumonia, urinary tract infections, nosocomial infections, wound infections, septicemia, meningitis, and rarely diarrhea too.

Isolation  in laboratory 

Klebsiella pneumoniae isolated from septicemic patient blood culture; on the basis of the following tests:-

Blood culture bottle incubated into Bactec.

After 23 hours of incubation, Bactec indicated positive.

The positive bottle was then sub-cultured into solid media Chocolate agar, blood agar, and MacConkey agar.

After overnight incubation, growth was seen in all three plates.

MacConkey’s Agar

On MacConkey agar, the colonies appeared large, mucoid, and pink in color. The mucoid nature of colonies is due to capsular material produced by the organisms.

Gram stain

Short thick Gram-negative rods

Motility by hanging drop preparation method

Non-motile

Biochemical tests

Catalase test -Positive

Oxidase -Negative

Nitrate reduction test- Reduced to nitrite

Triple Sugar Iron  (TSI) agar–

Acid/acid

No hydrogen sulfide (H2S) production

Production of gas

Motility Indole Urease (MIU) test

Non-motile because of only strict growth around the stab line

Urea hydrolyzation test-Test should be positive but here found negative may be due to Klebsiella pneumoniae subspecies rhinoscleromatis.

Indole -Negative

Note: Klebsiella oxytoca is indole positive.

Citrate Utilization Test

Positive

Fermentation of sugars (glucose, lactose, and mannitol )- acid and gas

Methyl red test-Negative

Voges-Proskauer test-Positive

Lysine decarboxylase test-Positive

Antibiotic sensitivity test

Antibiotic sensitivity test is also suggestive for Klebsiella pneumoniae because of ampicillin resistance which is intrinsically resistant.

Treatment 

Clinical isolates of Klebsiella pneumoniae are resistant to a wide range of antimicrobial agents like ampicillin, amoxicillin, and carbenicillin. This resistance is due to the R plasmid present in these organisms. Organisms are usually sensitive to cephalosporins, trimethoprim, nitrofurantoin, amoxicillin-clavulanic acid, and aminoglycosides. However, plasmid-mediated resistance to gentamycin and various cephalosporins has been reported in hospital strains.

#Related Videos

Klebsiella pneumoniae -introduction, pathogenesis, lab diagnosis and treatment

#K. pneumoniae growth on NA, BAP & MAC and its biochemical test-

#K. pneumoniae glucose utilization test using Andrade’s indicator-

# K. pneumoniae  under Microscope

Phenotypic and Molecular Characterization of Extended-Spectrum β-Lactamase Produced by Escherichia coli, and Klebsiellapneumoniae Isolates in an Educational Hospital

Abstract

Background: Extended-spectrum beta-lactamases (ESBLs) are a group of enzymes that hydrolyze antibiotics, including those containing new cephalosporins, and they are found in a significant percentage of Escherichia coli and Klebsiellapneumoniae strains. With the widespread use of antibiotics, difficulties with infection therapy caused by drug resistant organisms, especially those that have acquired resistance to beta-lactams, such as broad-spectrum cephalosporins, have amplified the above-mentioned organisms.

Objectives: This study was conducted to characterize ESBLs among E. coli and K. pneumonia isolates by molecular and phenotypic methods.

Materials and Methods: Different strains of E. coli and K. pneumonia were collected from patients with urinary tract infections. The ESBL phenotype was determined by a double disk diffusion test (DDDT). In addition, polymerase chain reaction (PCR) analysis specific for β-lactamase genes of the TEM and SHV family was carried out. The PCR products were run on agarose and examined for DNA bands.

Results: A total of 245 E. coli and 55 K. pneumonia strains were isolated from different samples. In total, 128 of the 300 isolates were confirmed as potential ESBLs producers as follows: 107 (43.67%) E. coli and 21 (38.18%) K. pneumonia. ESBLs genes were found in 24 isolates (18.75%): 21 E. coli and 3 K. pneumonia isolates. The TEM gene was present in 13 (12.14%) E. coli strains, but it was not detected in K. pneumonia. In addition, the SHV gene was present in 8 (7.47%) E. coli and 3 (14.28%) K. pneumonia isolates. Five (4.67%) of the E. coli isolates harbored both TEM and SHV genes. All isolates (100%) were susceptible to imipenem. The lowest rates of resistance to other antibiotics were observed for; piperacillin-tazobactam (6.25%), amikacin (12.5%) and gentamicin (14.84%). The rates of resistance to other antibiotics were as follow: nitrofurantoin (16.4%), nalidixic acid (23.43), co-trimoxazole (25%), cefepime (32%), ciprofloxacin (55.46%), ampicillin (69.53%), ceftazidime (100%), and cefotaxime (100%).

Conclusions: The results of this study indicate the widespread prevalence of ESBLs and multiple antibiotic resistance in E. coli and K. pneumoniae. Therefore, beta-lactam antibiotics and beta-lactamase inhibitors or carbapenems should be prescribed based on an antibacterial susceptibility test.

Keywords

Klebsiella pneumoniaEscherichia coli Phenotypic Molecular extended-spectrum β-lactamase (ESBL)

1. Background

The difficulties seen in combating infections caused by drug resistant organisms, especially those that have acquired resistance to beta-lactams, such as broad-spectrum cephalosporins, have resulted from the extensive use of broad-spectrum antibacterial agents. One important resistance mechanism to the beta-lactams, including new cephalosporins, is due to the destruction of the antibiotics by extended-spectrum beta-lactamases (ESBLs) (1). ESBLs were first described in the early 1980s among Klebsiella species, and then in Escherichia coli, Serratia marcescens, Pseudomonas aeruginosa, and other Gram-negative bacilli (2, 3). ESBLs are a group of enzymes that have an expanded substrate profile which allows for the hydrolysis of 3 and 4 generation cephalosporins and monobactams, but not carbapenems. ESBLs are prevented by β-lactamase inhibitors, such as; clavulanic acid, sulbactam and tazobactam (2, 4). These enzymes can be either plasmid or chromosomally mediated, but they are described mainly on plasmid that are frequently found among Enterobacteriaceae.

ESBLs are prevalent in every part of the world, and in addition, they are found in a meaningful percentage of E. coli and Klebsiella pneumoniae strains in certain countries (4, 5). ESBLs are continuous mutations that change the amino acid configuration near the active site of these β-lactamases, resulting in the development of new enzymes showing extended substrate profiles. Until now, more than 400 different ESBLs have been identified, and these are clustered into three groups: TEM, SHV and CTX-M, with 183, 134 and 103 variants, respectively. Among the previously mentioned ESBL variants, TEM and sulphydryl variable SHV were the major types in some countries (6-8).

Determination of ESBL genes, including TEM and SHV, by molecular techniques in bacteria that produce ESBL and their antimicrobial resistance patterns can provide applicable information about their epidemiology and risk factors related to their infections (2, 9). A number of studies have been carried out to recognize the types of ESBL producing Enterobacteriaceae in hospitals in Iran (1, 10, 11). In spite of the presence of ESBLs among K. pneumoniae and E. coli which have been reported from Isfahan (12), there is no information on their molecular types.

2. Objectives

The present study was conducted to determine the prevalence of TEM and SHV genes responsible for ESBL production amongst ESBL positive K. pneumoniae and E. coli isolated from urinary tract infection specimens of both hospitalized patients and outpatients.

3. Materials and Methods

3.1. Bacterial Isolates

In this study, E. coli and K. pneumonia strains isolated from patients suffering from urinary tract infections were studied. The isolates were collected from December 2011 to October 2012 from Al-Zahra Hospital, Isfahan. Tests were conducted on both hospitalized and non-hospitalized infections. Hospitalized infections were defined as patients who were confined to bed in hospital, while non-hospitalized infections were defined as infections in patients who had had no previous contact with hospitals or long-term care facilities in the previous two weeks. Bacterial isolates were characterized using biochemical tests. The samples were cultured on nutrient agar (Hi Media, India), MacConkey agar (Hi Media, India), blood agar (Hi Media, India) and eosin methylene blue (EMB) agar (Hi Media, India). The plates were incubated at 35°C for 24 h and the pure isolates characterized and identified according to Gram stains and biochemical tests such as; catalase, oxidative, indole production, citrate utilization, triple iron sugar, urea test, oxidative-fermentative test with glucose, ortho-nitrophenyl-β-galactoside (ONPG) test, and methyl red Voges-Proskauer, as described in standard bacteriological methods. All of the above chemicals and media were purchased from Sigma-Aldrich (Germany).

3.2. Antimicrobial Drug Susceptibility Testing

Antimicrobial susceptibility of the isolated bacteria was performed by the disk diffusion technique on Mueller-Hinton agar plates (Oxoid, UK), according to the recommendations of the Clinical and Laboratory Standards Institute (CLSI). The antibiotics (µg) tested included: amikacin (30), ampicillin (10), ciprofloxacin (5), co-trimoxazole (10), gentamicin (10), imipenem (10), nitrofurantoin (300), tazocin (110), ceftazidime (30), cefepime (30), nalidixic acid (30), and cefotaxime (30). The standard antibiotic disks were purchased from Mast Diagnostics (Mast Group, UK).

3.3. Phenotypic Screening of Extended-Spectrum β-lactamase

The isolates that showing resistance to one or more third generation cephalosporins (3GCs) were examined for ESBLs production by the combination disc method using; cefotaxime (30), cefotaxime/clavulanic acid (30/10), ceftazidime (30), and ceftazidime/clavulanic acid (30/10) (MAST Co. UK). A greater than or equal to 5mm increase in diameter of the inhibition zone of the cephalosporin-plus-clavulanate disc, when compared to the cephalosporin only disc, was interpreted as phenotypic evidence of ESBLs production. K. pneumoniae ATCC 700603 was used as a positive control and E. coli ATCC 25922 was used as a negative control. Standard strains were obtained from the American Type Culture Collection (Manassas VA).

3.4. DNA Extraction for Polymerase Chain Reaction

DNA templates for polymerase chain reaction (PCR) were obtained from the overnight growth of bacterial isolates on Luria–Bertani agar (Hi Media, India) that were pelleted by centrifugation, resuspended in 500 µL of sterile deionized water, and then boiled for 10 min. After centrifugation of the boiled samples at 19000 g for 5 min, the upper layer was used as a DNA template for PCR.

3.5. Polymerase Chain Reaction Amplification of β-Lactamase Genes

Bacterial isolates included in the study were screened by PCR for TEM and SHV genes. Specific primers and annealing temperature for amplifying the blaSHV and blaTEM genes by PCR are shown in Table 1. PCR was carried out in a 25 µL volume containing; 2.5 µL of 10X PCR reaction buffer, with MgCl2 (1.5 mM), 0.5 µL (200 µM) deoxynucleoside triphosphate mix (dNTPs, 10 mM), 0.5 µL of each primer (10 pm/µL), and 50 ng DNA template with 0.5 µL (3 U/µL) Taq DNA polymerase. PCR amplifications were performed on a Thermocycler TC-512 (Techne) and the PCR fragment was analyzed on 1% agarose gel. A molecular marker (Fermentase SM024: 80 to 1000 kb) was used to assess the PCR product size. PCR materials were purchased from Fermentase (Life Science, Germany).

Table 1.
PrimersTemperature, °CNucleotide Sequences, 5’-3’ReferencesSize, bp
SHV60(2)293
FCGCCTGTGTATTATCTCCCT
RCGAGTAGTCCACCAGATCCT
TEM60(2)403
FTTTCGTGTCGCCCTTATTCC
RATCGTTGTCAGAAGTAAGTTGG

aAbbreviations: SHV, Sulfhydryl Variable; F, Forward; TEM, Temoneira; R, Reverse.

4. Results

During a 10-month period, 245 E. coli and 55 K. pneumonia strains were isolated from patients with urinary tract infections. In total, 128 of the 300 isolates were confirmed as potential ESBL producers using ceftazidime/clavulanic acid and cefotaxime/clavulanic acid disks (Figure 1).

Confirmatory Test for Detection of Extended-spectrum β-lactamase
Figure 1.

The occurrence of ESBL in the isolates was as follows: 107 (43.67%) out of 245 E. coli and 21 (38.18%) out of 55 K. pneumonia. Of the 107 E. coli, 67 (62.62%) were isolated from hospitalized patients and the remaining 40 (37.38%) belonged to outpatients. Furthermore, of the 21 K. pneumonia, 13 (62%) were from hospitalized patients, while 8 (38%) were recovered from outpatients.

All ESBL-producing isolates were screened by PCR using blaTEM and blaSHV specific primers (Figure 2). ESBL genes were found in 24 isolates (18.75%): 21 E. coli and 3 K. pneumonia isolates. The overall data revealed that the TEM gene was present in 13 (12.14%) E. coli, but it was not detected in K. pneumonia, and the SHV gene was present in 8 (7.47%) E. coli and 3 (14.28%) K. pneumonia isolates. There were 5 (4.67%) E. coli isolates that harbored both TEM and SHV genes. All bacterial isolates were susceptible to imipenem. The lowest rates of resistance to other antibiotics were observed for: tazocin (6.25%), amikacin (12.5%) and gentamicin (14.84%). The rates of resistance to other antibiotics were as follows: nitrofurantoin (16.4%), nalidixic acid (23.43), co-trimoxazole (25%), cefepime (32%), ciprofloxacin (55.46%), ceftazidime (59.76%), ampicillin (69.53%) and cefotaxime (73.43%).

Lane M, 100 bp DNA marker; Lane 1, blaSHV from the positive control; Lane 2,E. coli clinical isolates expressing blaSHV; Lane 3, blaTEM from the positive control; Lane 4,K. pneumonia clinical isolates expressing blaTEM.

Lane M, 100 bp DNA marker; Lane 1, blaSHV from the positive control; Lane 2,E. coli clinical isolates expressing blaSHV; Lane 3, blaTEM from the positive control; Lane 4,K. pneumonia clinical isolates expressing blaTEM.

Figure 2.

5. Discussion

The treatment of infectious diseases is an important issue for human wellbeing and the daily increase in bacterial resistance has elevated patients’ costs in recent years. The production of ESBLs is also a major threat to the use of the new generation of cephalosporins. In the last two decades, the rate of ESBL production by Enterobacteriaceae has increased considerably (10, 13, 14). Among Enterobacteriaceae, K. pneumonia and E. coli are the most important causative agents of nosocomial infections (15) and these are usually isolated from patients with urinary tract infections in Al-Zahra Hospital, Isfahan; therefore, we selected these two types of bacteria for our study. Occurrences of infection effected by extended spectrum beta-lactamase producing K. pneumonia and E. coli have been widely reported all over the world following the widespread use of the expanded spectrum cephalosporins (11, 16-19).

In our study, phenotypic screening of ESBL showed that 43.67% of E. coli and 38.18% of K. pneumonia isolates were positive for ESBL production. Overall, 62.62% of E. coli were isolated from hospitalized patients and the remainder 37.38% belonged to outpatients. In addition, 62% of K. pneumonia were from hospitalized patients, while 38% were recovered from outpatients. Based on these results, the prevalence of ESBL producing K. pneumonia and E. coli was high. In addition, ESBLs producing organisms were higher in hospitalized patients compared to outpatients. The high prevalence of ESBLs producing E. coli and K. pneumonia has also been reported by a number of previous studies. For example in a study by Feizabadi et al. (1), they showed a 44.5% ESBL positive rate among clinical K. pneumoniae isolated from clinical specimens in Tehran (20).

In a study from Kurdistan, Ramazanzadeh et al. revealed a 34.8% ESBL positive rate among strains of Gram-negative bacteria (21) and Mobasherizadeh et al. showed that among a total of 2035 consecutive clinical isolates identified as E. coli in Al-Zahra Hospital, 898 (44.1%) and 432 (21.2%), were ESBL producers for hospitalized and non-hospitalized patients, respectively (22). Therefore, our findings were in agreement with the above-mentioned studies. On the other hand, the rate of ESBLs production is higher in other hospitals or cities in our country. For instance, the rates of ESBL producing K. pneumoniae isolated from Tehran indicated by Aminzadeh et al. were 52.5% in 2008 (23). Bazzaz et al. also showed that the prevalence of ESBL positive strains of E. coli and K. pneumonia was 59.2% in 2009 (24).

In another study that was performed by Jalalpoor and Mobasherizadeh. in 2009-2010 in Isfahan (12), the frequency of ESBLs in strains of E. coli in hospitalized and out-patients was 58% and 17%, respectively, and the frequency of ESBLs in strains of K. pneumoniae in hospitalized and out-patients was 64% and 22%, respectively. In that study, the samples were collected from Al-Zahra, Shariati, and Kashani hospitals and reference and Mahdieh laboratories. Their study results showed a higher frequency of ESBLs in isolated bacteria from hospitalized cases when compared to out-patients. Therefore, we see that our results are compatible with the results of the previously mentioned study. The presence of ESBL positive Enterobacteriaceae was also documented by Feizabadi et al. (1). From 104 isolates of K. pneumonia collected from four university hospitals in Tehran, they identified 75 (72.1%) ESBL producing isolates. Moreover, E. coli and K. pneumonia isolates producing ESBL are less prevalent in the Al-Zahra Hospital, Isfahan. In a study from Mashhad, Zaniani et al. revealed that 43.9% of E. coli and 56.1% of K. pneumoniae were ESBL producers and the frequency of SHV and TEM among the ESBL producing isolates were 14.4% and 20.6%, respectively (25). The prevalence of ESBLs varies from one hospital to another. It is uncertain whether this is because of the differences in infection control practices between hospitals or to differences in the use of new cephalosporins (11).

Our study, along with other studies, have also demonstrated that the rates of ESBLs production in our country are different from other countries in our area, such as; India (57.1%), Turkey (57%) and South Korea (30%), and published data from European countries, such as; France, Italy, the Netherlands, Germany, and Spain, as well as in the United States, Australia, Japan, Tanzania, Thailand and Pakistan, which showed a higher prevalence of ESBL-producing isolates in the present study (22, 26-28). Feizabadi et al. (1) found that the rates of resistance for tazocin, amikacin, ciprofloxacin, cefepime, ceftazidime, and cefotaxime were; 21.3%, 21.4%, 28%, 76% and 84.0%, respectively. The comparison of our study results with the above-mentioned study shows that antibiotic resistance to four of the previously mentioned antibiotics is lower in our study. In addition, in another study, both non-hospitalized and hospitalized isolates were more resistant to first line drugs including; ampicillin, and trimethoprim-sulfamethoxazole (22). This result, which is comparable with other studies in developing countries, is due to the widespread use of these drugs because of their low cost and easy administration.

Imipenem, amikacin and piperacillin-tazobactam were the most effective antibiotics against hospitalized ESBL-producing isolates. All ESBL-positive isolates were susceptible to imipenem, indicating that this agent is the best drug for treating serious infections caused by ESBL-producing E. coli. The carbapenem antibiotics including; ertapenem, imipenem, and meropenem, are commonly known as the first choice in the treatment of serious infections caused by ESBL-producing Enterobacteriaceae (22). The prevalence of the TEM gene in our study in E. coli was 12.14%, however, this gene was not detected in K. pneumonia. The prevalence of the SHV gene in E. coli and K. pneumonia isolates was 7.47% and 14.28%, respectively, which is lower than that reported by Karimi et al. (26% and 15% for E. coli, and 18% and 15% for K. pneumonia, respectively) (15), 54% and 67.4% for K. pneumonia (29) and 55.7% and 30.7% for K. pneumonia (1). Also in this study, 5 (4.67%) of the E. coli isolates harbored both TEM and SHV genes which is lower than that reported in India (67.3% 2003 to 2004) (26), (21.8% 2007 to 2008) in Kashan, Iran (10) and (34.7% 2006 to 2007) in Tehran, Iran (1). Therefore, we can conclude that the production of β-lactamase can result from other types of ESBLs among isolated Enterobacteriaceae. The emergence and expansion of ESBL-producing Enterobacteriaceae including, E. coli and K. pneumoniae is an alarming issue and the use of cephalosporins against these isolates is inefficient.

Nowadays, carbapenems are the drug of choice for the treatment of serious infection diseases in Iran. However, the appearance of resistance in this group of antibiotics, especially resistance to imipenem, may restrict their prescription in the future. Another concern is the tremendous increase in the prevalence of ESBLs, as the majority of these were resistant to other antibiotics. Because of the significance of ESBL producing Enterobacteriaceae including, E. coli and K. pneumoniae and the difficulties involved with the therapy of infections caused by these bacteria, clinical laboratories should adopt the employment of a simple test on the basis of the Clinical and Laboratory Standards Institute (CLSI) suggestions for the rapid identification and confirmation of ESBL production in Enterobacteriaceae. In addition, beta-lactam antibiotics and beta-lactamase inhibitors or carbapenems should only be prescribed based on an antibacterial susceptibility test.

Acknowledgements

The authors wish to thank the staffs of Al-Zahra Medical Center, Isfahan University of Medical Sciences.

References

  • 1.

    Feizabadi MM, Mahamadi-Yeganeh S, Mirsalehian A, Mirafshar SM, Mahboobi M, Nili F, et al. Genetic characterization of ESBL producing strains of Klebsiella pneumoniae from Tehran hospitals. J Infect Dev Ctries. 2010; 4(10) : 609 -15 [PubMed]

  • 2.

    Bali EB, Acık, L. , Sultan, N. . Phenotypic and molecular characterization of SHV, TEM, CTX-M and extended-spectrum B-lactamase produced by Escherichia coli, Acinobacter baumannii and Klebsiella isolates in a Turkish hospital. Afr J Microbiol Res. 2010; 4(8) : 650 -4

  • 3.

    Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P. Molecular characterization and epidemiology of extended-spectrum-beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob Agents Chemother. 2008; 52(8) : 2818 -24 [DOI][PubMed]

  • 4.

    Bradford PA. Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev. 2001; 14(4) : 933 -51 [DOI][PubMed]

  • 5.

    Helfand MS, Bonomo RA. β-Lactamases: a survey of protein diversity. Curr Drug Targets Infect Disord. 2003; 3(1) : 9 -23 [DOI]

  • 6.

    Barguigua A, El Otmani F, Talmi M, Bourjilat F, Haouzane F, Zerouali K, et al. Characterization of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates from the community in Morocco. J Med Microbiol. 2011; 60(Pt 9) : 1344 -52 [DOI][PubMed]

  • 7.

    McGowan JE, Jr, Hill HA, Volkova NV, Lawton RM, Haber MJ, Tenover FC, et al. Does antimicrobial resistance cluster in individual hospitals? J Infect Dis. 2002; 186(9) : 1362 -5 [DOI][PubMed]

  • 8.

    Paterson DL, Hujer KM, Hujer AM, Yeiser B, Bonomo MD, Rice LB, et al. Extended-spectrum beta-lactamases in Klebsiella pneumoniae bloodstream isolates from seven countries: dominance and widespread prevalence of SHV- and CTX-M-type beta-lactamases. Antimicrob Agents Chemother. 2003; 47(11) : 3554 -60 [PubMed]

  • 9.

    Jain A, Mondal R. TEM & SHV genes in extended spectrum beta-lactamase producing Klebsiella species beta their antimicrobial resistance pattern. Indian J Med Res. 2008; 128(6) : 759 -64 [PubMed]

  • 10.

    Khorshidi A, Rohani M, Moniri R. The prevalence and molecular characterization of extended-spectrum β-lactamases-producing Klebsiella pneumoniae isolates recovered from Kashan hospital university, Iran. Jundishapur J Microbiol. 2012; 4(4) : 289 -94

  • 11.

    Nasehi L, Shahcheraghi F, Sadat Nikbin V, Nematzadeh SH. PER, CTX-M, TEM and SHV Beta-lactamases in clinical isolates of Klebsiella pneumoniae isolated from Tehran, Iran. Iran J Basic Med Sci. 2010; 13(3) : 111 -8

  • 12.

    Jalalpoor S, Mobasherizadeh S. Frequency of ESBLs in Escherichia coli and Klebsiella pneumonia strains isolated from hospitalized and out-patients with urinary tract infection in selective centers in Esfahan (2009-2010). Razi J Med Sci. 2011; 18(85) : 7 -18

  • 13.

    Mendes C, Kiffer C, Segura A, Ribeiro J, Turner P. Klebsiella pneumoniae with multiple antimicrobial resistance. Braz J Infect Dis. 2004; 8(1) : 109 -11 [PubMed]

  • 14.

    Putman M, van Veen HW, Konings WN. Molecular properties of bacterial multidrug transporters. Microbiol Mol Biol Rev. 2000; 64(4) : 672 -93 [PubMed]

  • 15.

    Karimi A, Rahbar M, Fallah F, Navidinia M, Malekan M. Detection of integron elements and gene groups encoding ESBLs and their prevalence in Escherichia coli and Klebsiella isolated from urine samples by PCR method. Afr J Microbiol Res. 2012; 6(8) : 1806 -9

  • 16.

    Branger C, Lesimple AL, Bruneau B, Berry P, Lambert-Zechovsky N. Long-term investigation of the clonal dissemination of Klebsiella pneumoniae isolates producing extended-spectrum beta-lactamases in a university hospital. J Med Microbiol. 1998; 47(3) : 201 -9 [PubMed]

  • 17.

    Niumsup PR, Tansawai U, Boonkerd N, Polwichai P, Dejsirilert S. Dissemination of extended-spectrum beta-lactamase-producing Klebsiella pneumoniae and Escherichia coli in Thai hospitals. J Infect Chemother. 2008; 14(6) : 404 -8 [DOI][PubMed]

  • 18.

    Pathak A, Marothi Y, Kekre V, Mahadik K, Macaden R, Lundborg CS. High prevalence of extended-spectrum beta-lactamase-producing pathogens: results of a surveillance study in two hospitals in Ujjain, India. Infect Drug Resist. 2012; 5 : 65 -73 [DOI][PubMed]

  • 19.

    Wang XR, Chen JC, Kang Y, Jiang N, An SC, Gao ZC. Prevalence and characterization of plasmid-mediated blaESBL with their genetic environment in Escherichia coli and Klebsiella pneumoniae in patients with pneumonia. Chin Med J (Engl). 2012; 125(5) : 894 -900 [PubMed]

  • 20.

    Feizabadi MM, Etemadi G, Yadegarinia D, Rahmati M, Shabanpoor S, Bokaei S. Antibiotic-resistance patterns and frequency of extended-spectrum beta-lactamase-producing isolates of Klebsiella pneumoniae in Tehran. Med Sci Monit. 2006; 12(11) : BR362 -5 [PubMed]

  • 21.

    Ramazanzadeh R, Chitsaz M, Bahmani N. Prevalence and antimicrobial susceptibility of extended-spectrum beta-lactamase-producing bacteria in intensive care units of Sanandaj general hospitals (Kurdistan, Iran). Chemotherapy. 2009; 55(4) : 287 -92 [DOI][PubMed]

  • 22.

    Mobasherizadeh S, Shokri D, Zargarzadeh AH, Jalalpour S, Ebneshahidi SA, Sajadi M. Antimicrobial resistance surveillance among hospitalized and non-hospitalized extend-spectrum beta-lactamase producing Escherichia coli from four tertiary-care hospitals in Isfahan, Iran; 2008-2011. Afr J Microbiol Res. 2012; 6(5) : 953 -9

  • 23.

    Aminzadeh Z, Sadat Kashi M, Sha'bani M. Bacteriuria by extended-spectrum Beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae: isolates in a governmental hospital in South of Tehran, Iran. Iran J Kidney Dis. 2008; 2(4) : 197 -200 [PubMed]

  • 24.

    Bazzaz BS, Naderinasab M, Mohamadpoor AH, Farshadzadeh Z, Ahmadi S, Yousefi F. The prevalence of extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae among clinical isolates from a general hospital in Iran. Acta Microbiol Immunol Hung. 2009; 56(1) : 89 -99 [DOI][PubMed]

  • 25.

    Zaniani FR, Meshkat Z, Naderi Nasab M, Khaje-Karamadini M, Ghazvini K, Rezaee A, et al. The Prevalence of TEM and SHV Genes among Extended-Spectrum Beta-Lactamases Producing Escherichia Coli and Klebsiella Pneumoniae. Iran J Basic Med Sci. 2012; 15(1) : 654 -60 [PubMed]

  • 26.

    Lal P, Kapil A, Das BK, Sood S. Occurrence of TEM & SHV gene in extended spectrum beta-lactamases (ESBLs) producing Klebsiella sp. isolated from a tertiary care hospital. Indian J Med Res. 2007; 125(2) : 173 -8 [PubMed]

  • 27.

    Tasli H, Bahar IH. Molecular characterization of TEM- and SHV-derived extended-spectrum beta-lactamases in hospital-based Enterobacteriaceae in Turkey. Jpn J Infect Dis. 2005; 58(3) : 162 -7 [PubMed]

  • 28.

    Jeong SH, Bae IK, Lee JH, Sohn SG, Kang GH, Jeon GJ, et al. Molecular characterization of extended-spectrum beta-lactamases produced by clinical isolates of Klebsiella pneumoniae and Escherichia coli from a Korean nationwide survey. J Clin Microbiol. 2004; 42(7) : 2902 -6 [DOI][PubMed]

  • 29.

    Feizabadi MM, Delfani S, Raji N, Majnooni A, Aligholi M, Shahcheraghi F, et al. Distribution of bla(TEM), bla(SHV), bla(CTX-M) genes among clinical isolates of Klebsiella pneumoniae at Labbafinejad Hospital, Tehran, Iran. Microb Drug Resist. 2010; 16(1) : 49 -53 [DOI][PubMed]

  • Copyright © 2014, Ahvaz Jundishapur University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.

    Источник: https://sites.kowsarpub.com/jjm/articles/18759.html

    Klebsiella characteristics on MacConkey Agar

    Klebsiella pneumoniae basic characteristics:

    • GRAM-NEGATIVE RODS
    • NON-MOTILE
    • NON-SPORE-FORMING
    • CATALASE: POSITIVE
    • OXIDASE: NEGATIVE
    • FACULTATIVELY ANAEROBIC

    Klebsiella will produce acid, which lowers the pH of the agar below 6.8 and results in the appearance of pink colonies.

    Klebsiella and Enterobacter, produce mucoid colonies which appear very moist and sticky. This phenomenon happens because the organism is producing a capsule.

    Klebsiella on MacConkey

    Klebsiella on MacConkey

    Tags: Klebsiella, Klebsiella pneumoniae, mucoid colonies, اغار ماكونكي, جرثومة الكليبسيللا الرئوية, مستعمرات مخاطية

    Get Updates

    Subscribe to our e-mail newsletter to receive updates.

    Share This Post

    Tweet
    Источник: http://www.medical-labs.net/klebsiella-characteristics-on-macconkey-agar-3524/
    2009, Cilt 39, Sayı 1-2, Sayfa(lar) 016-021 [ Türkçe Özet ] [ PDF ] [ Benzer Makaleler ] EXTENDED SPECTRUM BETA LACTAMASES PRODUCTION AND ANTIMICROBIAL RESISTANCE RATIO OF THE ESCHERICHIA COLI AND KLEBSIELLA PNEUMONIAE STRAINS ISOLATED FROM VARIOUS CLINICAL SPECIMENSNurhan ALBAYRAK1, Şafak KAYA21Çankırı Devlet Klebsiella en agar emb, Mikrobiyoloji ve Klinik Mikrobiyoloji, Çankırı
    2Çankırı Devlet Hastanesi, İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji, ÇankırıKeywords: Escherichia coli, Klebsiella pneumoniae, extended spectrum beta lactamases

    Th e aim of this study was to determine the antibiotic sensitivity to Escherichia coli and Klebsiella pneumoniae strains isolated in Microbiology Laboratory of Çankırı State Hospital between January 2007 - March 2008. Urine, sputum and wound samples which send from various clinics were inoculated both sheep blood agar and EMB agar; and blood samples added to biphasic blood culture medium (Biomeriux) in accordance with routine procedures. Sputum and wound samples were analysed for the presence or absence of leukocytes with gram staining. Microorganisms identification have been realized according to the biochemical properties. Micoorganisms can not be identified with convational methods were determined with semi automized systems (Biomeriux; Api 20E). To some antimicrobial agents, antimicrobial susceptility was been made by Keurby Bauer disk diff usion testing according to the recommendations of Clinical Laboratory Standards Institute (CLSI). Extended spectrum beta-lactamase production of Escherichia coli and Klebsiella pneumoniae strains were evaluated by double disk synergy method. In this klebsiella en agar emb period 3156 urine, 703 sputum, 255 wound and 246 blood culture samples were sent to our laboratory. In 876 sample (20.9%) at least one bacteria was been isolated of total of the 4360 samples. Escherichia coli isolated from 347 sample and Klebsiella pneumoniae isolated from 91 sample. Th e extended spectrum beta-lactamase production rate was 18.8 % (n=73) in Escherichia coli, and 21.9% (n=20) in Klebsiella pneumoniae. Lower susceptibilty rates were determined among Escherichia coli and Klebsiella pneumoniae strains especially against amoxicillin/clavulonic acid and cefalosporins which are oft en used as empirical antimicrobials in various infections. Karbapenem resistance was shown only in a one Escherichia coli strain; karbapenem's still appear to be the most eff ective antibiotic against all tested bacteria.


    [ Türkçe Özet ] klebsiella en agar emb [ PDF ] [ Benzer Makaleler ]
    Источник: http://tmc.dergisi.org/summary_en.php3?id=338

    Klebsiella pneumoniae on MacConkey Agar

    Klebsiella pneumoniae on MacConkey agar is a mucoid and lactose fermenter isolated from urine as shown above picture.

    K. pneumoniae scientific classification is as follows-

    • Domain: Bacteria
    • Phylum: Proteobacteria
    • Class: Gammaproteobacteria
    • Order: Enterobacterales
    • Family: Enterobacteriaceae
    • Genus: Klebsiella
    • Species:  pneumoniae
    • Subspcecies of Klebsiella pneumoniae are-
    • Klebsiella pneumoniae subspecies ozaenae
    • Klebsiella pneumoniae subspecies  pneumoniae
    • Klebsiella pneumoniae subspecies rhinoscleromatis

    Klebsiella is from the surname of  German-Swiss microbiologist Edwin Klebs (1834–1913). Klebsiella is a genus of Gram-negative, oxidase-negative, fimbriated, non -motile, non-sporing klebsiella en agar emb bacteria with klebsiella en agar emb prominent polysaccharide-based capsule and having size o,f   0.5 -0.8 µm wide to 1 -2  µm. They are found everywhere in nature and also in bacterial flora in our intestines.

    Pathogenicity of Klebsiella pneumoniae

    It may cause severe bronchopneumonia, urinary tract infections, nosocomial infections, wound infections, septicemia, meningitis, and rarely diarrhea too.

    Isolation  in laboratory 

    Klebsiella pneumoniae isolated from septicemic patient blood culture; on the basis of the following tests:-

    Blood culture bottle incubated into Bactec.

    After 23 hours of incubation, Bactec indicated positive.

    The klebsiella en agar emb bottle was then sub-cultured into solid media Chocolate agar, blood agar, and MacConkey agar.

    After overnight incubation, growth was seen in all three plates.

    MacConkey’s Agar

    On MacConkey agar, the colonies appeared large, mucoid, and pink in color. The mucoid nature of colonies is due to capsular material produced by the organisms.

    Gram stain

    Short thick Gram-negative rods

    Motility by hanging drop preparation method

    Non-motile

    Biochemical tests

    Catalase test -Positive

    Oxidase -Negative

    Nitrate reduction test- Reduced to nitrite

    Triple Sugar Iron  (TSI) agar–

    Acid/acid

    No hydrogen sulfide klebsiella en agar emb production

    Production of gas

    Motility Indole Urease (MIU) test

    Non-motile because of only strict growth around the stab line

    Urea hydrolyzation test-Test should be positive but here found negative may be due to Klebsiella pneumoniae subspecies 1st premier login -Negative

    Note: Klebsiella oxytoca is indole positive.

    Citrate Utilization Test

    Positive

    Fermentation of sugars (glucose, lactose, and mannitol )- acid and gas

    Methyl red test-Negative

    Voges-Proskauer test-Positive

    Lysine decarboxylase test-Positive

    Antibiotic sensitivity test

    Antibiotic sensitivity test is also suggestive for Klebsiella pneumoniae because of ampicillin resistance which is intrinsically resistant.

    Treatment 

    Clinical isolates of Klebsiella pneumoniae are resistant to a wide range of antimicrobial agents like ampicillin, amoxicillin, and carbenicillin. This resistance is due to the R plasmid present in these organisms. Organisms are usually sensitive to cephalosporins, trimethoprim, nitrofurantoin, amoxicillin-clavulanic acid, and aminoglycosides. However, plasmid-mediated resistance to gentamycin and various cephalosporins has been reported in hospital strains.

    #Related Videos

    Klebsiella pneumoniae -introduction, pathogenesis, lab diagnosis and treatment

    #K. pneumoniae growth on NA, BAP & MAC and its biochemical test-

    #K. pneumoniae glucose utilization test using Andrade’s indicator-

    # K. pneumoniae  under Microscope

    Klebsiella pneumoniae

    microscope picturegram-negative rods

    Mucous, lactose positive colonies of Klebsiella pneumoniae on MacConkey agar. Cultivation 37°C, 24 hours.

    As a general rule, Klebsiella infections tend to occur in people with a weakened immune system. Many of these infections are obtained when a person is in the hospital for some other reason (a nosocomial infection). Klebsiella en agar emb most common infection caused by Klebsiella bacteria outside the hospital is pneumonia. Klebsiella ranks second to E. coli for urinary tract infections in older persons. It is also an opportunistic pathogen for patients with chronic pulmonary disease, enteric pathogenicity, nasal mucosa atrophy, and rhinoscleroma. Feces are the most significant source of patient infection, followed by contact with contaminated instruments.
    Microscopy:
    Gram-negative, non-motile, encapsulated, rod shaped bacterium.
    Источник: http://www.bacteriainphotos.com/Klebsiella%20pneumoniae%20on%20MacConkey.html

    Related Videos

    Klebsiella Colony Morpholohy on MacConkey agar

    4 Replies to “Klebsiella en agar emb”

    Leave a Reply

    Your email address will not be published. Required fields are marked *